Review Breakdown,amino acid

Human IL-2 signal peptide sequence is a critical element in understanding the intricate processes of interleukin 2 production and secretion. This short, hydrophobic leader sequence, attached to the N-terminus of the nascent IL-2 protein, acts as a molecular passport, directing the protein to the endoplasmic reticulum for further processing and eventual release from the cell. The precise amino acid sequence of this signal peptide is paramount for efficient protein translocation and subsequent biological activity.

Interleukin-2 (IL-2), a crucial cytokine within the immune system, plays a pivotal role in regulating T-cell growth, differentiation, and survival. It is primarily produced by activated CD4-positive helper T-cells, with lesser contributions from activated CD8-positive T-cells and natural killer (NK) cells. The IL-2 cytokine family is a vital component of the adaptive immune response, orchestrating complex cellular interactions.

Understanding the human IL-2 signal peptide sequence is not merely an academic pursuit but has significant implications in various biotechnological and therapeutic applications. Researchers have explored modifications to this signal peptide to enhance protein secretion, as demonstrated by studies showing that alterations can augment protein secretion both in vitro and in vivo. This has led to the development of strategies for optimizing signal peptides for increased recombinant human IL-2 production.

The human IL-2 signal peptide sequence is characterized by its hydrophobic nature, facilitating its insertion into the lipid bilayer of the endoplasmic reticulum membrane. While the exact sequence can vary slightly, a commonly referenced signal sequence for human IL-2 is MRRMQLLLLIALSLALVTNS. This sequence is essential for initiating the secretion pathway. Another example of a functional IL-2 signal peptide sequence found in research is ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG. This particular sequence has been utilized in expression vectors like pCDNA3 IL-2 signal mFc to facilitate the secretion of fusion proteins.

The mature form of human IL-2 is typically 133 amino acids long, with the signal peptide being cleaved off during the translocation process. The primary translation product of human IL-2 contains 153 amino acids, and this is processed to a mature form by the cleavage of a 20-amino acid leader, which constitutes the signal peptide. The amino acid sequence of mature IL-2 can be found in various databases, with UniProtKB providing detailed information, including the IL2_HUMAN identifier. For instance, the Human IL2 protein sequence is a well-documented entity.

The importance of the signal peptide extends to the design of recombinant proteins. For example, in constructing expression vectors like pCDNA3-IL-2 signal, the IL-2 signal peptide is placed at the N-terminus of the gene of interest to ensure its secretion from mammalian cells. Similarly, Recombinant human IL-2 (hIL-2) Ala21-Thr153 is a common form used in research, where the mature protein sequence starts from alanine at position 21. Another notable variant is Recombinant human IL-2 (IL-2) carrier-free, which is also specified by its amino acid range, such as Human IL-2, amino acids Ala21-Thr153.

Furthermore, the human IL-2 signal peptide sequence has been a subject of interest in directed evolution studies. Researchers have used phage display libraries derived from human Interleukin-2 (IL-2) to identify mutated variants with enhanced display levels, suggesting that modifications to the signal peptide or other parts of the protein can significantly impact its properties. The Suggested Antigen Peptide Sequences for IL2 Gene often highlight regions that are crucial for antibody recognition, and the signal peptide itself can be a target for specific antibodies or assays.

The IL-2 cytokine functions by binding to the IL-2 receptor (IL-2R), which is composed of several subunits, including the alpha, beta, and gamma chains. This binding event triggers downstream signaling pathways, primarily involving JAK1 and JAK3 phosphorylation, leading to the activation of STAT, PI3K, and MAPK pathways. These signaling cascades ultimately mediate the pleiotropic effects of IL-2 on immune cells. The 2 Signaling pathways are therefore directly influenced by the proper expression and secretion of IL-2, which is initiated by its signal peptide.

In summary, the human IL-2 signal peptide sequence is a fundamental determinant of Interleukin-2's journey from synthesis to secretion. Its precise sequence and function are vital for the proper functioning of the immune system and hold immense potential for therapeutic advancements and biotechnological applications. The study of human IL-2 and its signal peptide continues to be an active area of research, shedding light on cellular communication and immune regulation. The **